Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB54YA04FM1
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00001599001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: SPT2, SPT2 chromatin protein. This family includes the Saccharomyces cerevisiae protein SPT2 which is a chromatin protein involved in transcriptional regulation..
Pfam Number: pfam08243 Score: 186 E_value: 4e-15

Sequence:
>SY0AAB54YA04FM1
TTGGGGTGTCATGTCTTCGTTGAAGGGCAAAGATAAGGACAGGGGCAAAC
ACTTGGAAGCCGGTATGAAGAGGAAGCGCGAAAGTCCTCCGCCAAAATCC
GGATACTCTAGCTACTCAAGAAACAAATATTCCACCAACCACAAACGATA
TGGATATGGGCCCCCCCGGCCAGATTCGTATGAAGAAGACGATCCCGATG
ATGATTTCGTGGTTAATGATGAGGATGATGAAGACGATGCATATGGCAGG
GGTGGTGGCTATGGCGGCTTTGCAAAGAAGAAATATTCATACATTGATTA
CGATTCAGCCAGTGACATGGAAGCTACCGGGGCAGATGTATTGGAAGAGG
AAGAACGCAGTCGTCGTGTCGCCGCCAAAGAGGATGCTGCGCAAGAGAAA
TTTGAAAGAGAGCTGGCTGCCAAAAAAGCAGCCCTCAAGAAGAAGGGTGT
CCTCACGAAGAAGAAGTAATTGCGATTTCAAGGGCTTTCCAACGTTTCGA
ACATTCCCCGTATCACTATCACTCCCACTTTCATTTCCTGTAATATTCTT
AGGCCTTTGTCGAAGTTCATTAGGTACATCTCCTGTTAGGCGATCCTTTC
GCACCTAATCCCTAGCTAAAAACAGGTTTCCTGCTAAATTTTTTTTTTTT
TCATCTC

Sequences in the Contig:

SY0AAB54YA04FM1