Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB53YL20FM1
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00010936001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05998
Accession: ref|XP_001593076.1| Score: 405 E_value: 6e-38
KEGG Definition: hypothetical protein
Accession: ani:AN5301.2 Score: 380 E_value: 2e-35
KOG Definition: No Hit Found
PFAM Definition: Fungal_trans, Fungal specific transcription factor domain..
Pfam Number: pfam04082 Score: 156 E_value: 1e-11
Swissprot: Q9UTN0|YII3_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle

Sequence:
>SY0AAB53YL20FM1
TTGGACCTCAAATCCCTCCTTGACGAGTCGCCTCCAGCAACTGGTCGCCT
CCCCAACATCACCGGATGCAACCTCCAGCGTGCCCTCGTCCCCCCTCTTC
GGGTCCGCCACCGAAAACCTGTCAATGTTCCACCCTACTCCCACCGAATC
TGTCCAGCTGTACAAAAGATATCTCGTCGCTGTCGACCCGGTAGCACGGC
TTTTACATAAGCCAACCTTTGAGCCAAAGTTGGCGAGACTACAAGAAAAT
GGCCCTGAATCAGAGGATCTGCATGCGGATAGAGGATTTGAAGCTCTCGT
TTTTTCAATCTATTATGCCGCGGTTAACAGCCTTCGCCCGGATAAGGTGC
TGCAAATGTTTGGCGTAGACAAACCGAGTTTACTGAACAGATATCGTGTA
GCTGTAGAGCATGCACTGGCTAACGCTGGATTTCTACAAAGTGAAGAATT
GACGACACTACAAGCCCTTGTCCTATTCATCACCTGCTCCCGAGCTGTAG
ATGACACTCGAACTCCATGGGTGCTTGTTGGCGTAGCAATTCGGATAGCA
CAAAGCATGGGCCTTCATAGAGACGGCTCAATTTTCCGCATAAACCCCTT
AGAAACCGAAATCAGGCGGAGACTTTGGTACGAAATATGTTTGCTCGA

Sequences in the Contig:

SY0AAB53YL20FM1