Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB53YL16FM1
Length(NT) : 587
Best Gene Model Blast : Link to GSTUMT00005810001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03624
Accession: ref|XP_001244183.1| Score: 183 E_value: 3e-12
KEGG Definition: hypothetical protein
Accession: ang:An02g06220 Score: 174 E_value: 1e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB53YL16FM1
TTGGAAGTGGGTCAGGTGGTGGTGTAGCACCCGGCAACCCACCGCCAGTT
AGCTCAAAGCCGAAGCCTGCTATTCCTCCTAGGACAGGAGGGATTGGTGG
AAAAATTGCTGCTCTGAAAGCCGGCTTCATGAACGACCTCGATCAACGGC
TGAAGCTAGGTCCTCAAGCTCCGAAGCAGGAGGAGAATCCTGTAGGCGAG
GAAGATAAGCCAATGGAGGTCCTGAGTGATGTGCGAAAGAGCAGGGCCAG
AGGGCCAAGAGGAAGGAAGTTGCCAACCGCCAAGGAGGCCGAAACCAAGA
CTGAGACCAAGGCCGACCCCGCAGCATTCAAGATGGAGATTGTTGGTGTT
TGGACTGTATGGAGTATGAATGAGGAAGGGGTCAACGTGGGCGAAGAGTC
AACGATTAGCTCCGCAGGCGAGTCAGAAACAGGAACCAAACCCGAACCAA
TGGCCGAAGACAAGAAGGAGGAGATGGCAACAACTCCTTCGGCAACAACT
CTCCCCGGGGCCACCGGCACTGGCCGACAAACGGTCCCTGCGGTGAGTAA
GGACTTTGATACCACTGCTGCCCCCCCTAGCCCGAAA

Sequences in the Contig:

SY0AAB53YL16FM1