Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB53YH22FM1
Length(NT) : 595
Best Gene Model Blast : Link to GSTUMT00006345001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_07904
Accession: ref|XP_001798230.1| Score: 186 E_value: 1e-12
KEGG Definition: hypothetical protein
Accession: ang:An12g00890 Score: 155 E_value: 2e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB53YH22FM1
TTGGCCTCCCATGTCCAGGGGCAGCCAGTTCCACCTTCTCGGTATGAAAA
CCCTTCTCAAGTACTCCAAGGGTAAAGAGTTGGGGCTTTTCGACTCCGAA
GGGAATCTCCCGATTCATACTGTTCTCCGAAGAAATCTGGCGATCCCCGC
CCGCCTGCTCTTGTCCCTCAAGCCAGAACACATAAACACGGAAAACGCCT
CGGGCCGCACCCCACTGGAGATCGCAACGAGCAATTACCTCACAAAGATC
TCCCAAAAACCCCAAGCCATACACGCCCAGGGTTACCACGGCGGGATCTT
TAGACCCCGGCTCTTTGGTTTCTCCCCTTCAGAGGACAGCGCTTCGGAAG
TCTCAGAAAATGGGGAACCACCGGAGAAAATGTATGATGTGCCCAACGTA
GATTCCGCTTTCAAGCTCGCATGCAAGGCGGCTCAGGAGGCTAGGTGCGG
TAGGACGTTAGTCAGCCTACTCGAGGCACGGAGCCTCGTGCAGAGGTTGC
AGGGTAGCGATAATCTACCCGTCAGCGAGGAGGAGGAAGTGGTATATAGG
GGCCAGCGCGAGGTGGAGGGGCAGTTCGATCCTATGTGGGCGGTA

Sequences in the Contig:

SY0AAB53YH22FM1