Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB53YH03FM1
Length(NT) : 376
Best Gene Model Blast : Link to GSTUMT00000129001 E-value : 1e-141
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57405.1| Score: 339 E_value: 1e-30
KEGG Definition: GDP-mannose pyrophosphorylase [EC:2.7.7.13]; K00966 mannose-1-phosphate guanylyltransferase
Accession: aor:AO090003000189 Score: 339 E_value: 6e-31
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1460 Score: 304 E_value: 3e-29
PFAM Definition: NTP_transferase, Nucleotidyl transferase. This family includes a wide range of enzymes which transfer nucleotides onto phosphosugars..
Pfam Number: pfam00483 Score: 137 E_value: 7e-10
Swissprot: O60064|YBB2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006013 = Biological process: mannose metabolic process

Sequence:
>SY0AAB53YH03FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCTCCCCTCTACTCCTCG
TCAACCATCACTGCCTTCTTCCGACAAACTATCTTTCACACAGTCCCTTA
TTTCTATCTCTCAGCATAAACAACATGTCTAACAAAGCTCTCATCCTCGT
CGGAGGCCCTTCCAGGGGAACTAGATTCCGCCCTCTATCTCTTGATCTCC
CCAAGCCCCTGTTCGAGGTTGCCGGCCACCCCCTCATTTACCATCCCCTC
AAGGCGGTTGCAAAAGTTCCTTCCATCAAAGAAGTTTACTTGATTGGCTA
CTACGAGGAATCTATCTTTGCGCCATACATTCGCCAGTGGTCTACGGAAT
TCCCTCAGTTCACGATTAAGTATCTA

Sequences in the Contig:

SY0AAB53YH03FM1