Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB53YG11FM1
Length(NT) : 570
Best Gene Model Blast : Link to GSTUMT00010987001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_01168
Accession: ref|XP_001560336.1| Score: 462 E_value: 1e-44
KEGG Definition: hypothetical protein
Accession: ang:An01g02000 Score: 447 E_value: 3e-43
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0628 Score: 400 E_value: 6e-40
PFAM Definition: Pyridoxal_deC, Pyridoxal-dependent decarboxylase conserved domain..
Pfam Number: pfam00282 Score: 262 E_value: 5e-24
Swissprot: Q7XHL3|TYDC1_ORYSJ
Gene Ontology:
GO:0004837 = Molecular function: tyrosine decarboxylase activity

Sequence:
>SY0AAB53YG11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAATCATTTCACCAGCTTCT
AAAAAATCGATCCACCCCTTCTGCACATTCTGTGAGCGCGTGAATATAAA
CAATCCATCTACAGGAACCTTTTTAGCTTTCCGCTTTCCGTTTTGCCTTT
GACTTTACCTTTCCGTCTCACCCATTTATCTGCGGACCTATTTCTCCCCC
CTTTTCTCCCCCCTTTTCTCCTTGCCATGGATTCAGAGCAATTCCGGGCA
GCTGCTTACTCTGCCATTGACCAGATAATCGACTACTATGACACTATCGA
ATCCCGCCGCGTAGTCTCTAACGTCTCGCCTGGATACCTTAAACCCCTCC
TCCCTTCGGGACCCCCAGCCAATCCTGAACCCTGGGCCGACATTCAATCA
GACATAGAATCCAAGATCCTCCCCGGGATAACCCATTGGCAAAGCCCTAA
CTTCCTCGCATTCTTCCCCGCGAACTCCTCATACCCCGGTATCCTGGGAG
AACTCTACTCTGCCACCTTCAATAGTGCAAACTTCAACTGGCTCTGTTCC
CCCGCCGCGACAGAGTTGGA

Sequences in the Contig:

SY0AAB53YG11FM1