Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB53YF21FM1
Length(NT) : 644
Best Gene Model Blast : Link to GSTUMT00002386001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06753
Accession: ref|XP_001592512.1| Score: 431 E_value: 6e-41
KEGG Definition: hypothetical protein
Accession: ncr:NCU02757.1 Score: 399 E_value: 1e-37
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0438 Score: 315 E_value: 5e-30
PFAM Definition: Ribosomal_L2, Ribosomal Proteins L2, RNA binding domain..
Pfam Number: pfam00181 Score: 238 E_value: 4e-21
Swissprot: Q9Y7P4|RML2_SCHPO

Sequence:
>SY0AAB53YF21FM1
TTGGGTCCACCTGACGGAAGGTCAGCAATAACGATGCTCCAATCACTGCT
GGCCCGGGCTCTCCTCCGGCGGCCAATTCCTCCCGGCCAACTAATCGATA
GTAGACTTCATCAATTACCGACGCTCGCACGGCTGGTGTCCACCACTCCC
GGGCCCCCAGCATCAACACCCCCGCTAGCCGCAGAGCCGGAAGCCCCAGA
CATGGTCCTTTGTTAATACCTTTACAGCACGTATCAAAGACGACAGCCGA
CGCCGCGGTTCTGGCGCAACAACCGGCTCCTCACGCAACCTGAAAATGCG
CACATACAAGCCCCGCACACCAGGTCTCCGTCATCTCAAACGCCCAATAG
AAGACCACCTCTGGAAAAAGGGCCCCTTCAGGCCATTAACCTTCGCAAAG
AAGCGCACTGGTGGGCGTAACCACACGGGGAGGATAACATGTCGACACAA
AGGAGGTGGACACAAGCGGAGGATCCGAACGGTGGACTTCCACAGGCTCG
CCCCGGGCCAACATACGATCGACCGGATCGAGCGTGATCCGGGGAGGAGT
GCTCACATAGCACTAATCACCAATAACGCTACCGGCCGGAAGAGCTACAT
TCTCGCGGCCGACGGCCTGCGCGCTGGGGATACGGTGCAGTCGT

Sequences in the Contig:

SY0AAB53YF21FM1