Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB53YD08FM1
Length(NT) : 629
Best Gene Model Blast : Link to GSTUMT00002430001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU09095
Accession: ref|XP_964912.1| Score: 170 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: ncr:NCU09095.1 Score: 170 E_value: 5e-11
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Cell motility].
Kog Number: KOG4115 Score: 133 E_value: 6e-09
PFAM Definition: No Hit Found

Sequence:
>SY0AAB53YD08FM1
TTGGACGCTTAGTGAGGACGACCTCACCTCGCTTCTGAATCGTATCTCCC
AGAAAAATACTGTTCAGTCTCTCATTATCCTCGACCGCTCTTCTGGCGCT
ATTATTCGGTCGTCAGGGTCCATAGCTGCCCACCGGGACTCGGAGAGTTT
AGTTGGAGAATATGCTGGGATGGTGTGGAACTTTGTTAAAAGCGCAGAAG
AAATGGTTTGTGGTATGGATGAGCAGGACGACTTGAGATTATTACGCATT
AGGACTAAGAGACATGAGTTGGTAATAGTGCCCGGTAAGCCATATGTACT
CTACTCTAGATTAGTAGAGTACGGCGTGTCTGACATGTTCCAATTGTTTG
CAGACCCCCGCTTCATATTAGTGGTGTTCCATGACACACCTCCAGCATAG
AACATAAAGGAGAAGCAGTCTGATGGGGCTTAATGGATGTTGCGATGCGT
TCTAAGGGTGTTTGAGAGTGTTCTCACTATAAATATGTTGGTGCCAAGGT
GACTACAGCATTCACGGAGTTAAACACGCCGTTCCTGGGCTGTATCTCCC
AGTCATCTCCGCCCCAATATACCATACATTCCCTCCTGAGAAAGCATGGG
AATGGTGGGAGCCAGTGAGCCACATAGTA

Sequences in the Contig:

SY0AAB53YD08FM1