Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB53YB08FM1
Length(NT) : 554
Best Gene Model Blast : Link to GSTUMT00001817001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_01708
Accession: ref|XP_001247937.1| Score: 340 E_value: 1e-30
KEGG Definition: hypothetical protein
Accession: ang:An08g10720 Score: 317 E_value: 3e-28
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3566 Score: 144 E_value: 2e-10
PFAM Definition: Gaa1, Gaa1-like, GPI transamidase component. GPI (glycosyl phosphatidyl inositol) transamidase is a multi-protein complex. Gpi16, Gpi8 and Gaa1 for a sub-complex of the GPI transamidase. GPI transamidase that adds glycosylphosphatidylinositols (GPIs) to newly synthesised proteins..
Pfam Number: pfam04114 Score: 190 E_value: 1e-15
Swissprot: Q9WTK3|GPAA1_MOUSE
Gene Ontology:
GO:0003923 = Molecular function: GPI-anchor transamidase activity
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAB53YB08FM1
TTGGCAGAGTTTCTTCTTTTATCTGTTGATGGCTGAAAGGAGGTTTGTTA
GTATCGGCACGTACTTGCCAAGTGCTATGCTGATTGCGGTTAATTTTACA
ATTGCTGCTATCGGGCTCTGGTTGAAAAGTGGGAGGTTGAATGACAAGGT
GGAAGGCCAGAGCACCGATGGGAAGGTTTCGGAAGAGAAGAGACTGTTGA
AGTCTGCGGGGGAGGCACCTTCCTCCACTGAGCAGCTGGATGCGGTTAGT
GAAGAACGACCATTGCTTCTATCGATGGCATTCGTCGTTGCCATCCATTT
CTTAGGATTTATACCCTTGTACCTATTTAACAATCTCAACGAGAAGAACT
CCGCCGGCGCGTTCTATATCTTCACTCTACTCAACGTAGTTCTTCCACCG
GTTCTGTGCGCAATCTTTACAAAATCATTTGCACCCACATCTCTACATTT
CACCTTGATCAAATGCTTTTCGCTCCTCCTGCTAGGAATGTTCCTCTCAG
CTTTGGCAACACTTAACTTTTCACTCTCCTTCCTCATTGGCGTCTTTGCT
TCTC

Sequences in the Contig:

SY0AAB53YB08FM1