Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YP06FM1
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00010685001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_01851
Accession: ref|XP_001221072.1| Score: 283 E_value: 7e-24
KEGG Definition: hypothetical protein
Accession: ncr:NCU03268.1 Score: 249 E_value: 3e-20
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1069 Score: 286 E_value: 9e-27
PFAM Definition: RNase_PH, 3' exoribonuclease family, domain 1. This family includes 3'-5' exoribonucleases. Ribonuclease PH contains a single copy of this domain, and removes nucleotide residues following the -CCA terminus of tRNA. Polyribonucleotide nucleotidyltransferase (PNPase) contains two tandem copies of the domain. PNPase is involved in mRNA degradation in a 3'-5' direction. The exosome is a 3'-5' exoribonuclease complex that is required for 3' processing of the 5.8S rRNA. Three of its five protein components contain a copy of this domain. A hypothetical protein from S. pombe appears to belong to an uncharacterised subfamily. This subfamily is found in both eukaryotes and archaebacteria..
Pfam Number: pfam01138 Score: 136 E_value: 3e-09
Swissprot: P53256|RRP46_YEAST
Gene Ontology:
GO:0000177 = Cellular component: cytoplasmic exosome (RNase complex)
GO:0000176 = Cellular component: nuclear exosome (RNase complex)
GO:0000175 = Molecular function: 3'-5'-exoribonuclease activity
GO:0006402 = Biological process: mRNA catabolic process
GO:0006364 = Biological process: rRNA processing

Sequence:
>SY0AAB52YP06FM1
TTGGGTCACTACCACCACCACCACCATCACCACAATCACAACACAACACA
CACCCCCCCAAAAAAGACAATGTCCGCCCCAACAGCCCTCCTCTCACCCC
TCCCAATGGCCGACGGTTCCGCGCAATACACGGACGGCCCAACAACCCTC
CTAGCATCAATCAACGGCCCGATAGAGGTAAAGCCCAGAGACGAAATCCC
GCTAGAAGCTTACCTAGAGATAACAATTAGGCCCTCCGCCGGAGTTACCT
CTGTTCGCGAAAAACACCTAGAAGCCCTCCTTCGCTCCGCCATATCCCCA
CTCATAATACGTACTGCCTACCCCCGCACGCTTTTGCAAATCACCTTACA
GGTTATCCAGCATGAGCAGGCGTCCATGGCGTACGCATTACATACTTTGT
TGACTTCGGCTATAGTGGTTGTCATGCTCGCGCTCGTCGATGCGGGGGTC
CCGATGAGGGGGATGCTGGCTGCGGCCTTCGTGGAGGAGGGTGATGGGAG
TGCGGCGCATGTTTTCGGGTATGCGATTACGGGCGGTGGCGGAGGATGGG
GAGGTATTAAGGAGGGATTGGTATTTGTGGAGAGTGATGGGGTATTTGAC
GAGAAG

Sequences in the Contig:

SY0AAB52YP06FM1