Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YO13FM1
Length(NT) : 563
Best Gene Model Blast : Link to GSTUMT00011948001 E-value : 1e-152
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_04552
Accession: ref|XP_362107.2| Score: 99 E_value: 6e-09
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04552 Score: 99 E_value: 3e-09
KOG Definition: No Hit Found
PFAM Definition: UBX, UBX domain. This domain is present in ubiquitin-regulatory proteins and is a general Cdc48-interacting module..
Pfam Number: pfam00789 Score: 109 E_value: 3e-06

Sequence:
>SY0AAB52YO13FM1
TTGGGCCGATGCGCTTGAGACTGAGGGTGGTCTTCCTGAGCCTCCGAATT
CTGATAAGCCGGTGGTCTCGGTTTTTAGGCCTTCGCAGTCTAATACACTT
GCAGCGACTCAGATCGATGTTCCGGACAAAGCATACGAGGTTGGAATCAC
TGAAGCCAAACTTATCCAGGCGAACATCAAGAAGGAGACTATTGGGAAAC
GCTTGCCTTCTGATAGAGAGATTGAAGAGAGGAAAGCCGCCGCGCTTGCG
GAGGCGGAGAAAGTCGAGAGGGTATGTGCAATGCTTGGGTGAGAGGTTGG
ATCCAGTCGCTCATAGGTGCTATCTACAGGTTGTGATCAAAGTCCGTTTC
CCGGATGGATATACCTCTGAACAGAACTTTGACAAGACTCATACTTCCCA
GGATCTCTACGATACAGTCAGAGGCACCCTCCGCCATCCCAACGAACCTT
TCCTTCTAAGGATCCCTCCCAGAGAAACCCTCCCTCAAGCACCAAAACGA
CTTACCACTGACCTCAAATTGCGAACTGGTGCTACCGTGCATCTAGTCTG
GGGCCCCGACGTC

Sequences in the Contig:

SY0AAB52YO13FM1