Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YN24FM1
Length(NT) : 593
Best Gene Model Blast : Link to GSTUMT00006442001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN2246.2
Accession: ref|XP_659850.1| Score: 266 E_value: 6e-22
KEGG Definition: hypothetical protein [EC:2.7.11.1]; K08860 eukaryotic translation initiation factor 2-alpha kinase
Accession: ani:AN2246.2 Score: 266 E_value: 3e-22
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0198 Score: 186 E_value: 4e-15
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 189 E_value: 2e-15
Swissprot: Q9HGN1|GCN2_SCHPO
Gene Ontology:
GO:0043561 = Biological process: regulation of translational initiation in response to osmotic stress

Sequence:
>SY0AAB52YN24FM1
TTGGCAGCCAAGAGAATGGCCTCCCGCTGGTGCTTAAACAGGCGGATGTC
CCTTTTCTTGAATGCGAAGGGTATGGATGGGAAAAAGAAAGTACAAAATC
TGGAGTTGGAACTGGACGAGATGAGGGGACTGAGGCATAATAACGTTGTA
GAAATTTACGGCAGCAAGGTTTTCCGCATCGACACTTTGTCAAATGGTGG
CTATGAGAATTCATCTGGCTCTACAGGGGGTTGGCGAATATCTATACTTA
TGGAATACTCTAATAAGGGAAGCCTGCACGATTTGCTGGAAACCGTGGGC
CAACTTAGTGTCGATATTGTTAGAGCATGGACTATCTCTTTGATAGAGGG
CTTGGATTACATCCACCGAATGGGAACGGTTCATGGAGGGATCCGCGCCC
AGAACATTCTTTTATTCCGCGACAGCTCGGGTGACTCAACCATCCCCAAA
CTCACGGACATAGGCTACACGCTAGCGTTACGGGAGATCATAGGCAACGA
GCATGGGCATCCTGAAACCTCGACGGCTGCATCAGCAAAACCCGTTTCTT
GGCTCCCTCCAGAAAACGCGAACCAGGTAAAAGCCAAACAAAG

Sequences in the Contig:

SY0AAB52YN24FM1