Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YN21FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00003627001 E-value : 1e-133
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_14242
Accession: ref|XP_001547359.1| Score: 232 E_value: 5e-18
KEGG Definition: hypothetical protein
Accession: ani:AN8945.2 Score: 209 E_value: 1e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB52YN21FM1
GTTGGGGGGACAACTTTGTACAAAAAAGTTGGCCAACCCTGAATAGCTAC
TAGACTTGTTTTTCACTACCGACAACTCACTACTCTCAGGTCTTATATGC
CCTACTCAGGTGAATGGCCCACAACCACGATCAAAGTTCCACAAGTGCTG
GAGCCAACATGTCTTCGTCACTCCAACCTAACGCAGCACCTTCTATTGAG
ACTGGACTCTCAACGGAAAGCTCAAGCCAAGAAGGATTACAAAATTACCT
TATGGAAGCGGATAGTTTCCCCCCAGATCTCTCGGACGATCAGGGGATTG
GTGACGATTTATCCACGTATACTGCTTCTCTTTCCTCCAGCGTGTTGAAT
TATCAATACGAAAACGGTCGCAGATACCATGGCTATCACCGAGGAAGTAA
GTTTCTTTTTTCAACTCGAGCAGTTTTTTATTTTTATTTATTTATTAATC
CAACAGACTATGTATTTCCGAATGATGAGCAAGAAATTGAGCGGCTCCAG
TTACAACATCATATGATGGCTATTCTATTCAGCGGAAGGCTGTACTGGGC
ACCCATTGATCCCAATCCACAAAAGATCCTGGACAT

Sequences in the Contig:

SY0AAB52YN21FM1