Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YM19FM1
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00011834001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_03854
Accession: ref|XP_001595765.1| Score: 451 E_value: 3e-43
KEGG Definition: hypothetical protein
Accession: ncr:NCU03607.1 Score: 412 E_value: 5e-39
KOG Definition:
Classification: [Signal transduction mechanisms, Amino acid transport and metabolism].
Kog Number: KOG1251 Score: 472 E_value: 3e-48
PFAM Definition: PALP, Pyridoxal-phosphate dependent enzyme. Members of this family are all pyridoxal-phosphate dependent enzymes. This family includes: serine dehydratase EC:4.2.1.13 P20132, threonine dehydratase EC:4.2.1.16, tryptophan synthase beta chain EC:4.2.1.20, threonine synthase EC:4.2.99.2, cysteine synthase EC:4.2.99.8 P11096, cystathionine beta-synthase EC:4.2.1.22, 1-aminocyclopropane-1-carboxylate deaminase EC:4.1.99.4..
Pfam Number: pfam00291 Score: 259 E_value: 2e-23
Swissprot: O59791|YCNE_SCHPO

Sequence:
>SY0AAB52YM19FM1
TTGGGTCACTGCTTTGAGAGAGAGCATACCGGCGATAGATAAAGGAAAGG
GAAAAAGAAAGAAAGACTGGGAAGCTCTGAAAGTCTGAAACAAAAAAAGC
AATGTCGTTAGCGCAGCTTCCACTTACAAGAGAATCCGTGCTAGAAGCAC
ATGCATTGATCAAGTCGCGCATCCACCGTACTCCTGTATTTACCTCCACG
ACACTATCAAAGCTCGCATCATCGGGTGATATGAACGTCAATTTACTCTT
CAAATGCGAGAATCTCCAAAAGATCGGCGCATTCAAGATTCGCGGAGCAA
CACATGCCCTCGCCCGGCTTACGGACGAGGAATTGCGAAAGGGTGTTGTG
ACTCACAGTTCGGGTAACCATGCGCAAGCGCTCGCACTTGCGGCAAGAGA
GGCCTCTTCGGTAAGAGGCTTCAAGATACCCTGCTGCGTCGTCATGCCGC
GCATATCCACGCCGTCTAAGATCGCCGCGACGGAAGGATACGGAGCGCAG
GTGGTCTTTTCGGGATCCACATCTGCGGAGCGAGAAGCTGAGGTTAGGGT
GGTCCAGGAGAGGACGGGAGCGGTGCTCGTGCCGCCCTACGATCATCCGC
ATATCGTACTTGGACAGGGCACTATGGCGGTGGAGCTAGCTGAACAGGCG
GAAGAGCTCGGGATGCCATT

Sequences in the Contig:

SY0AAB52YM19FM1