Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YL11FM1
Length(NT) : 593
Best Gene Model Blast : Link to GSTUMT00007757001 E-value : 1e-178
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_02708
Accession: ref|XP_001793305.1| Score: 350 E_value: 1e-31
KEGG Definition: protein involved in high osmolarity signaling pathway
Accession: aor:AO090011000468 Score: 295 E_value: 1e-25
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2141 Score: 411 E_value: 3e-41
PFAM Definition: MA3, MA3 domain. Domain in DAP-5, eIF4G, MA-3 and other proteins. Highly alpha-helical. May contain repeats and/or regions similar to MIF4G domains..
Pfam Number: pfam02847 Score: 120 E_value: 2e-07
Swissprot: O13971|SGD1_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus

Sequence:
>SY0AAB52YL11FM1
TTGGGTTATCATGATGCAGCCCGCTATTGCTAAGATTGGCTATGAAAACC
TTAGCATCAGAACGAAATTTATGATCGAAACGTTGACAAATCTTAAGAAC
AACCGTTTGAAAGCGGCAGCCGCTAACTCAGTTGTAGTTGCGGAAGCAAC
AATTCGCAAGAAGTCTAAGAAAGATCCGGAAGACCTCGACTTTTACTCGA
ACACAGACCTCTTGCAATTAGCCCGAGAGCAACGAATGAACACAGACATC
CGACAGGCAATCTTCGTAGCCATCATGTCTGCGGAAGACTATACGGACGC
ATACCTCCGTATTCTAAAACTCCGACTAAAGCGCAAGCAAGAGCCTGAGA
TACCCCGTGTTCTCATCCATTGCTGCGGTTCAGAAGCTTCATACAATCCC
TACTATACACTCGTTGCCCGAAAGCTCTGTGCGCAGAATAACCTGCGTAT
GGCCTTCACATTCAGTCTTTGGGGGGTATTCCGTCGTATGGGCGAGGGCG
AGGGGGGAGGGGAGGCGGATCTCTTTGGCGAAGATGGCGAGAACGATGAA
GACTTAGACATGCGGAAGATCCTCAATCTTTCCAGGATGTACG

Sequences in the Contig:

SY0AAB52YL11FM1