Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YK05FM1
Length(NT) : 459
Best Gene Model Blast : Link to GSTUMT00009766001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57634.1| Score: 274 E_value: 4e-23
KEGG Definition: predicted protein
Accession: aor:AO090003000457 Score: 274 E_value: 2e-23
KOG Definition: No Hit Found
PFAM Definition: SBDS, Shwachman-Bodian-Diamond syndrome (SBDS) protein. This family is highly conserved in species ranging from archaea to vertebrates and plants. The family contains several Shwachman-Bodian-Diamond syndrome (SBDS) proteins from both mouse and humans. Shwachman-Diamond syndrome is an autosomal recessive disorder with clinical features that include pancreatic exocrine insufficiency, haematological dysfunction and skeletal abnormalities. It is characterised by bone marrow failure and leukemia predisposition. Members of this family play a role in RNA metabolism. In yeast these proteins have been shown to be critical for the release and recycling of the nucleolar shuttling factor Tif6 from pre-60S ribosomes, a key step in 60S maturation and translational activation of ribosomes. This data links defective late 60S subunit maturation to an inherited bone marrow failure syndrome associated with leukemia predisposition..
Pfam Number: pfam01172 Score: 222 E_value: 2e-19

Sequence:
>SY0AAB52YK05FM1
TTGGCTTTACAAATCTTCACATTTATCCAACCAACAAGCAAGCATGCCTC
GTGGAAACGGTGAACAGACTAAGGTTGTCTACAAGGGCAAGAACGAGGAC
TTCATTGTCTTTGTCGAGTCGGTGGAAAAGCTCAATAAATGGAGAAAAGA
TCCCTCGATCCCTCTTCTCGACGTAGTTGATTCGTTCAAGGTGTTCTGTA
CGCACAAGCACGGGGCACAAGGGATCCTCGACGAGGCTGGAGGCGGCCTC
CTAGAAGGCGAATTCGGATCCAAGAAAGAAGACGAAGTGGTTAAGAGGAT
TCTCCAGGGCGGGACTTTCCAGCGTGGTGTTGTCGAAGAACGCCAAGGAG
ACAGGAACGTTTCAGATGGACCCATGCAAGTTCAGGGTTATATTTTCTGA
ATTATTTTTTAGTCTTTTCTCTTCAAGGGGTCTTTGCATATGCAGCCTGT
TTCCTTTTT

Sequences in the Contig:

SY0AAB52YK05FM1