Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YJ11FM1
Length(NT) : 516
Best Gene Model Blast : Link to GSTUMT00007366001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_01493
Accession: ref|XP_001792131.1| Score: 195 E_value: 7e-14
KEGG Definition: hypothetical protein
Accession: yli:YALI0F04422g Score: 140 E_value: 9e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q86ZN7|KAPR_TRIAT

Sequence:
>SY0AAB52YJ11FM1
TTGGCACAGTTTGGTTTTCAATAACCAAGAATTACCTTCTCCAGACATCT
CCAGAGCAACTCAATTTGTTTGTTCCTACCCCTCCACCACCCCCAAGCAC
ATAAGATCAGGATAGGGGAATGTCACTCCCGGAAGCTTACCTCGACGAAG
TCAACGCACTCAACCGCGAGATACTAAAATCCAAACCCACGGACGTTCTC
CAGTTCTGTGCTAACTTCTTCAATCGCCGCCTCGAAGCTCAGCGAGTCGA
ATTCCTGCTATCTGCTTCAAATAACTCTGGGTTTTCCTCTTCAAATACTT
TCGGAGCAATGCCAAGTTCCTCAGCATATGGTGGCGGTGAAAGCCTCTTC
CCTGGCTCCGTAGTGAATCTCGGTGGCCCCCCTTTAGATGGGAATCGCGA
GAGCCCTTTTTCCGGAACAATAAGAGAAGAAGATGAAGACGTTGGACAGA
GCCCAACTACCCCTAGCTTCAGACCGGCCGTTCTCGGAGGTCCTAGTATT
TCGAATCCCAGCCTGG

Sequences in the Contig:

SY0AAB52YJ11FM1