Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YG23FM1
Length(NT) : 656
Best Gene Model Blast : Link to GSTUMT00010668001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: pre-mRNA splicing helicase, putative
Accession: ref|XP_001262021.1| Score: 815 E_value: 2e-85
KEGG Definition: pre-mRNA splicing helicase, putative
Accession: afm:AFUA_8G04740 Score: 815 E_value: 9e-86
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0951 Score: 580 E_value: 8e-61
PFAM Definition: Sec63, Sec63 Brl domain. This domain (also known as the Brl domain) is required for assembly of functional endoplasmic reticulum translocons..
Pfam Number: pfam02889 Score: 377 E_value: 3e-37
Swissprot: Q9UT24|BRR2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005681 = Cellular component: spliceosome
GO:0000393 = Biological process: spliceosomal conformational changes to generate catalytic conformation

Sequence:
>SY0AAB52YG23FM1
TTGGAGAGGATGTGGCCAACTATGACCCCGTTTCGACAATTTACTGCGGC
CCCCACGAATCAGCTCGCCCCCATTGTAACGAAGGCCGAGCGTGCTGCTG
AGTTCACCTGGTCCAAGTACTTTACTATGGATCCCCCTCACCTAGGGGAG
CTCTTCAACAGCGCAAGAGCGGGAAAGTTGGCCCACAGCTTATTAGAGAG
GTTTCCGAGATTAGATGTTCAAGCTCAAGTACAACCGGTAACTAGGAGCC
TTCTCAAGGTTGAGTTGACCATCACACCTGACTTCATCTGGGACGATGCA
TATCACGGCACAGCAGAGACATTCTGGATCTTGGTTGAAGATTGCGACGG
TGAAGAGATACTATTCCACGATCAATTCATTCTACGCAAGCAATACGCCG
AAAGCGAAAACAATGATCATCTGGTTGAGTTCACGGTACCAATGACAGAA
CCAATGCCTCCTAATTACTTTATCACTCTTGTTTCCGATAGATGGATGCA
CTCAGAAACTAAGCTAGCCGTATCGTTCAGGAAATTAATTCTTCCAGAGA
AATTCCCACCACACACACCCTTATTGGGTCTGGTGCCTTTACCTGTTGAG
GCGTTGAAAAAACCGGAATTTGTCAATCTCTACCCTGAATGGCGGGAGTT
CAATAA

Sequences in the Contig:

SY0AAB52YG23FM1