Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YD11FM1
Length(NT) : 688
Best Gene Model Blast : Link to GSTUMT00006633001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001217500.1| Score: 148 E_value: 4e-08
KEGG Definition: hypothetical protein
Accession: ani:AN7092.2 Score: 142 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB52YD11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCCAACTACGATAAAGA
AACCGGACAAGCAAATATCCTGCAGATTGAGAGAGACGCCCGCGGGCGGG
TCGCCCAGCGGAAAGTCTGCTCAACAGAACTTTTGAACTCGCTCTCATTC
TCTCCCGACGACCTCGCAGCCACGGTACAAACGTCTCTGCACTACGGCCA
CGGTGCAACGGTCGTGGAGAAAGATCGGGCAAACTGGATCATGAAGTCCC
AGCACATGAGCACATGGCTAACCTCCACAACCCCCAGTACACTGCTAGTA
AACGGCAACGGCGAACGTAAGAAGATCTCCCCGTTATCGTTCATAACAGC
CCTGCTCGTGCAATCGTTGACCCAATCCGACATTCCTGTCCTACACTACT
TCTGCGGCGACAACACCGGCAGCAGTGGTGGTGGCCCTTCAGGTCTAATA
AGTAGCCTGACAGCGCAATTGTTAACACACTACGATTTCGACCTGACCAC
CATCCGGCACTCGCGAAAGGGCGCACCAAAGACGACGAAGCAGCTGTGCG
CCCTTTTTGAAAGCCTCCTCACGCAATTGCCCGACGACGCATTGCTCTTC
ATACTCATCGACGGGATTACCTACTTTGAAAACGCCGACCGCCGCGAGGA
GACGTGTCTTGTCATTGAAAAACTCCACGAGATCTCGC

Sequences in the Contig:

SY0AAB52YD11FM1