Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YC22FM1
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00007883001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Pfs, NACHT and Akyrin domain protein
Accession: gb|EDP52187.1| Score: 270 E_value: 2e-22
KEGG Definition: Pfs, NACHT and Ankyrin domain protein
Accession: afm:AFUA_5G14582 Score: 270 E_value: 1e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB52YC22FM1
TTGGATCGCCCACAATATCCTGAGCAGCAAAGCACTGAAAATGTCTCAAT
CTCTTAGCAACAATATCAACTCCCTGAACACCGTGACGAATAACTTTATT
GTTCCCGATGATCGATCTAATATCCTAGCCTGGTTATCCCCGCTAGATCC
CAGGCCACGGCATCAGGACATCCGAGACCGCCGAGTCGAGAATGTAGGGG
AGTGGGTCTTACAGACTGAGGAATATAGAAGCTGGTACGCAGGTAGTAGG
GGAAGCGAATCGGTTTTGTTTTGCTATGGGGATCCGGGGGTGGGGAAAAC
ATATATTAGCTCATTGGTCATAGATAGATTATGCGATCAGGTCGGAGGAC
GAGATCTTGCCGTTGCATGTTTTTACTGTGACTTCGCGGCCCAGAAGGAA
CAGTCATCGACGAACATGCTGGGCGCCTTGCTCAAACAGGTTGTGAGTGG
AATGGGGGTGGTGCCAGGGGAAATAGCGCAAGCATATGAAGACCAGAAAA
AAGGAATTGGTGGACGGGGACCGCAGCTTGCTGATGTTGTGAAGATGCTG
CAAACAGCATCTTCCGAAAATCATATATTCATATGCATCGATGCTATGGA
TGAATGTGCGGAAGGATATCGG

Sequences in the Contig:

SY0AAB52YC22FM1