Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YB17FM1
Length(NT) : 545
Best Gene Model Blast : Link to GSTUMT00011193001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE55837.1| Score: 329 E_value: 2e-29
KEGG Definition: Fe2+/Zn2+ regulated transporter
Accession: aor:AO090005000823 Score: 329 E_value: 1e-29
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG4842 Score: 191 E_value: 8e-16
PFAM Definition: WLM, WLM domain. This is a predicted metallopeptidase domain called WLM (Wss1p-like metalloproteases). These are linked to the Ub-system by virtue of fusions with the UB-binding PUG (PUB), Ub-like, and Little Finger domains. More specifically, genetic evidence implicates the WLM family in de-SUMOylation..
Pfam Number: pfam08325 Score: 355 E_value: 7e-35
Swissprot: P38838|YHT4_YEAST
Gene Ontology:
GO:0016925 = Biological process: protein sumoylation
GO:0006974 = Biological process: response to DNA damage stimulus
GO:0010224 = Biological process: response to UV-B
GO:0010225 = Biological process: response to UV-C

Sequence:
>SY0AAB52YB17FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGCCTGGTCTGTCTTGTCTG
TCTGCCTAATTTGCTTTCTCTCTCCAACCTTCCTATCATACCTACCCACC
TACCCAACCTATTCAACCTACCTTCCTCACAACTCCTTCAACCTCGACAT
ATCGACTTCAACACCAACCAGTGACAGACAAAGATGACGCAAGACCAAAT
AATCGGTACATATGTGCACATCCCGGGGAAACCGAGGGAGCAGCACGCCC
TCTACATGCTCCGGTGGATTGCCAGCCTGGTGAAGCCTATAATGAACAAG
GGGGGGTATAAGGTGGGCTGTTTGGCTGAATTTTATCCTGTGCAAAAGAG
CTTACTCGGCTTGAACGTCAATAATGGTGAAAAGGTCTGCATAAGGCTCC
GCCAACCCTACGATGATAGCGTATTCTTGGACATTGAGGAGTGTGTTTAT
ACGATGCTGCATGAAATCACACACAACCTCCACGGTCCCCACAACGACAC
ATTCTACGCCCACTTGAAAACCCTCGAAGAGTCCTACTCCACCCT

Sequences in the Contig:

SY0AAB52YB17FM1