Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YB14FM1
Length(NT) : 583
Best Gene Model Blast : Link to GSTUMT00002350001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_10414
Accession: ref|XP_001228341.1| Score: 437 E_value: 9e-42
KEGG Definition: mitochondrial ribosomal protein L16
Accession: aor:AO090026000423 Score: 401 E_value: 7e-40
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3422 Score: 271 E_value: 5e-25
PFAM Definition: Ribosomal_L16, Ribosomal protein L16p/L10e..
Pfam Number: pfam00252 Score: 283 E_value: 2e-26
Swissprot: P38064|RM16_YEAST
Gene Ontology:
GO:0005762 = Cellular component: mitochondrial large ribosomal subunit
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0006412 = Biological process: translation

Sequence:
>SY0AAB52YB14FM1
TTGGATTACTAACATATACTGGTGAAGATGCAATCGTTCTTCCCGTCAAT
CGCACCTCTGTTGCGCACAGAGGTGCAGTCAATCCCCCTCCTAAGACTCT
TCTCCACAACTTCCACCCCACAAGACTGGCTCCGTATAATATCCCTCCCC
CCCACCAACTCCCCACCCCGCCCAAAACTCCCTAACACCCACAGTCAGGT
CCCCGCACCGACCCAAAACTCCGCTTCAAGGGCAACCCACGCGTGCACAC
CGGCGGCTCCACCCGCGGGACCACGATAGCCTGGGGCGACTACGGCATGC
GATTATCCGACTACCACCAACGCCTGTCCGCAACACACCTAAAAAATGCA
GAAACAGCAATAAAGACCAAACTCCGCGGGATGAAGTACAAATTGTACAA
GCGGGTCGCATGCAACATCGCCGTGTTCCAGAAGGGCAACGAGGTGCGCA
TGGGGACAGGGAAGGGCACACATAAGTTCTGGGCAGCCAGGGTTCCCGTT
AGTCGTGTGCTTTTCGAGCTCAAGGGGGAGGTGCACGAGCAGATTGTCAA
GGAGGCGTTTAGGTTGGCGGGGGATAAGATGCC

Sequences in the Contig:

SY0AAB52YB14FM1