Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB52YA22FM1
Length(NT) : 482
Best Gene Model Blast : Link to GSTUMT00009645001 E-value : 1e-123
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_05183
Accession: ref|XP_001224397.1| Score: 97 E_value: 5e-06
KEGG Definition: hypothetical protein
Accession: ncr:NCU05316.1 Score: 84 E_value: 4e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB52YA22FM1
TTGGGCTCAGTGATGCCGGGTCGGCAAACAAGGATAATAAGTTATATTGA
AGTGAATGATGAATTGCCTAAGTTTGGAGGATGTGCACGGTGCGGCGCTG
GAGGAATAAAGGCTCGGGCCAATGAGAAAGCAAAACTTGGGACGGCGACT
CCCATGTAGGTATCTCATTCGTAGCGGCCGTTACAGGTGGATGCACTCTG
CCACGCTCTGGCAGTCGAAGTTGGATCTATGGATCTCAGTACCGACGATG
TTCCTTGGATATGGCACTGCTACTCTGCCGCCAAAGACTTGTCGTGGGTA
AAGAAGCTTCGGCTGCCCGCTTGATCCACTTTACCCTCCAAGAGTATCTT
TCCACGCATCCAGACCTTTTCGGCAGAGCACAGTCGACTATCGCAGAAAC
CTGTTTGACCTATCTGAATTTCCAGCATATCAAGGACCTATCGCTCATAT
GCCATACTACCTTTCAAGAAAATCCCTTTCTG

Sequences in the Contig:

SY0AAB52YA22FM1