Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB51YP15FM1
Length(NT) : 468
Best Gene Model Blast : Link to GSTUMT00009411001 E-value : 1e-164
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_02506
Accession: ref|XP_001558872.1| Score: 245 E_value: 1e-19
KEGG Definition: hypothetical protein
Accession: ang:An07g10190 Score: 243 E_value: 8e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB51YP15FM1
TTGGCTTCGAAAGCAACGCCCGGAACATCCATGATATAGCCGCTAACAAG
CAAGTGGGCAAGCGACAGGTTCAAGGCAGATATGTGGGCCCTGGTAGCCA
GAGAGATGGAGATCCCCTGGAGAGCTGCTGAGGCCATGCATTGGCAACTT
GGAGAACGGGAAATGGCTCGTCGGGCTGGCGTCGTTCCCTTCTCCCTCAG
CAACATCGCCCTCGACGCTCAGCCAAAGAGAACTGGTAACGTGGGAACGA
CCGGACGTAAGGGCCAGAATTCCGGGAGCACGAATAACTCCGCTACCGGG
CCGTCGGCACCCCCAACGGAGGCGGGCTCCGCACCAGAGAGCCAGGGTGC
TGCGTGATAATAATAATAATAATTTCCGGATGACGCTGGCCGCACGGTAA
CGGCAATGCGTGGGGATAATGGTGAGTTCATTCGGGAGTCTCCGGTGGGT
GTTTTTCTTCTTTCTTTT

Sequences in the Contig:

SY0AAB51YP15FM1