Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB51YN24FM1
Length(NT) : 521
Best Gene Model Blast : Link to GSTUMT00002762001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 404 E_value: 4e-38
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 325 E_value: 3e-29
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 237 E_value: 3e-21
PFAM Definition: No Hit Found
Swissprot: Q7T163|ARMS_DANRE

Sequence:
>SY0AAB51YN24FM1
TTGGCAGCTCTTATATGGGCAGCTGTAAGAGGGAACGAGGAGGTGGTAAA
GGTGCTTTTGGATCGAGAAGATGTTAATCCCAACCAGACAGACATCAAAC
ATGGCCGAACGCCACTCACGTGGGCCGCTAGGAGCGGCCATGAGGCGGTA
GTAAAGCTACTTCTGAAACGGGTGGATGTCGATCTCAGCCAGGCAGACAC
CGAATATGGCCGGACGCCACTCTCGTGGGCCGCTGAGAATGGCCATGAGG
GGGTAGTAAAGATGCTTTTAGAACGAGCGGATGTCAATCCTAACCAGGTA
GATATCAGATACGGTCAGGCGCCGCTGTCGTGGGCCGCTAAGAAGGGGCA
TGGGGGGGTGGTAAGGTTGCTTTTAGAGCGAGTGGATGTCAATACCGACC
AGGCGGACAGCAAATATGGTCAGACGCCGCTCTCATTGGCCGCTGAGAAC
GGGCATGAGGCGGTAGTAAAGATGCTTTTAGAACGAGTGGATGTCAATCC
CAACCAGGCAGACACTTTTTG

Sequences in the Contig:

SY0AAB51YN24FM1