Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB51YN09FM1
Length(NT) : 595
Best Gene Model Blast : Link to GSTUMT00004165001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_04546
Accession: ref|XP_001557296.1| Score: 181 E_value: 4e-12
KEGG Definition: kelch repeat protein
Accession: afm:AFUA_4G14350 Score: 171 E_value: 3e-11
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0379 Score: 114 E_value: 9e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAB51YN09FM1
TTGGGGTACCCATACAACAGTACGATTTTCGGACCGAGAAGCGCTCCCAT
CATGAGCAAGAAATGGAGATATGACATTGCAACTAGACGGTGGACGAATA
CGAATATAATTCTGAGGAATTGGTTTCGGGCCAACAATTCACGGAGGGTA
TCTAGTCCAATGACAGCATGGGTTCCATCATTGAAGAAAGGTTTTCTTTT
CGGTGGCTATTTTTCCAAGGTAAACGAAACGACGCTCAAGGTGACAGCAC
AAGAGGAACATCCCGGCCTAATCACTTATGAACAAGCCACTAATACATGG
ACAAACGAAACTATACCATTTGGAGGAATATCCGAAGGGGGCTTAGTGCA
TATTACGACAGCTACAGATGAGGTCTTGATTCAGCTTGGTGGAAGGACTC
AATGGTACACTCGCATGGTACAATTTTCCGAGATCAGAGTCTACAGCACG
AAACAAGCAAGATGGTTTACCCAACGTCTACAATCTGATGCCCCGATTCC
AGCTCCTCGATTCGCCTTCTGCACTGCTGTCAAATCAGCTTCTGATGGTT
CCAGTCATCAAATCTACATTATGGGAGGCCTTGAAACTAGCAGTC

Sequences in the Contig:

SY0AAB51YN09FM1