Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB51YM05FM1
Length(NT) : 535
Best Gene Model Blast : Link to GSTUMT00009666001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 220 E_value: 1e-16
KEGG Definition: ankyrin
Accession: aor:AO090023000667 Score: 192 E_value: 9e-14
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 164 E_value: 1e-12
PFAM Definition: No Hit Found
Swissprot: Q5KP49|AKR1_CRYNE
Gene Ontology:
GO:0031901 = Cellular component: early endosome membrane
GO:0000139 = Cellular component: Golgi membrane

Sequence:
>SY0AAB51YM05FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCTAGTAGGTATTGGGGA
ACCCACGCAAAAATGGAACTCTCGGAGAACGCGAAATCACTTGCGCTGCA
GCTATTCAGCCAGTACGATGGCCACATATCTGCAAGGATACTTTTACAGC
AGGTATGTAGTTGGGGTTGCGCTGAACATGGCTCTAGTTCTGTGTTCACT
GGACTGCACTGTGCATCCTTTTTTGGAATTGCGGCGCTTGTGGATGCTTT
GATGGGGATGGAGAGTTGTGGTATCAACAAAAGGGATTCGGTGGGTGTTA
CGCCGCTCATATGGGCGGCTATGTGTGGGCATCAGGATGTCGTGAAGCTG
TTCCTGGGGCGGGGGGAAGTCGACCTCGATGTACCGGATGGGGCTTACGG
ACGGACGGCGCTCTCGTGGGCTAAAACGAATGGGCACGAGGGGGTGGTGA
AGCTATTGCTGGGACGTGAAGGCGTCGACCCCTATGGGCCTGATGATAAT
ACCGGTAGCTGGACAAAACGCTCGCGGGCTGCGTT

Sequences in the Contig:

SY0AAB51YM05FM1