Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB51YJ15FM1
Length(NT) : 533
Best Gene Model Blast : Link to GSTUMT00011006001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12811
Accession: ref|XP_001586234.1| Score: 369 E_value: 5e-34
KEGG Definition: hypothetical protein
Accession: ani:AN0352.2 Score: 364 E_value: 1e-33
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1134 Score: 228 E_value: 4e-20
PFAM Definition: No Hit Found
Swissprot: Q06538|YL241_YEAST

Sequence:
>SY0AAB51YJ15FM1
TTGGCTCTTCTGTTCCCCGTACAGAGGGCCAGGATGGGCTATTCACACTT
TACACGATGGAGTAACGCTCTTAAGGAGTAATAATGATACGCACATCGGA
CTTCCGACAGATACGAGGAGGACCGATTTACCAACCCAGCTAGTTATCTC
CACGACTCTTGGATTGGGTGCTTTCTTGACGTTTTGTTTCTTGAGGCCAA
GGTGGTCCTCGCTCTACGCGGCGCGGAAAAAGACACTTGATTCAGCTGCG
TCATTACCGAATTTACCAAAGACTTTCTTCGGCTGGATACCGGTGCTGTG
GGAGATAACGGATGAGCAAGTACTGTCGTCTGCTGGTCTTGATGCCTATG
TGTTTTTGTCATTTTTCAAGATGTCTATTAGATTCCTATCGATTGCAGCT
GTGCTAGCGTTGGGCTTGCTCATGCCTATACATCTGCACTTTGACCACTC
GGTCTCGAAACCTCGGGTTTCGTTTTCGGAATGGGCACTCAGACCTGCTG
GTCGGGGGATGAATGTCCTTGGTGGTAAAGATA

Sequences in the Contig:

SY0AAB51YJ15FM1