Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB51YI06FM1
Length(NT) : 734
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: orf441
Accession: ref|NP_074928.1| Score: 280 E_value: 2e-23
KEGG Definition: homing endonuclease, LAGLIDADG/HNH
Accession: tpt:Tpet_0746 Score: 169 E_value: 9e-11
KOG Definition: No Hit Found
PFAM Definition: LAGLIDADG_1, LAGLIDADG endonuclease..
Pfam Number: pfam00961 Score: 214 E_value: 3e-18
Swissprot: P15563|YMN3_PODAN

Sequence:
>SY0AAB51YI06FM1
TTGGATGAACTTTTAACTCCTATTGCCTTAGCTCATCTTATAATGGGATA
TGGTTCTGTTTAACGACATGGCTTAATAATATGTACTAATAGTTATTCAA
TAGAAGATATAGTTATATTAATGAATGTTCTTATGATTCGTTATAGATTA
GAATGCACAATACATAAAAAAAAAAGACAAAATAATAAAATTGAACATAT
GATTTACATTAGACAGAGTTCTATACCTTTACTTCGTACTATTGTAACTC
CTTATTTACATTCTTCTATGTTATATAAGATAACTTCTATGAGTTATAAA
AAAAGTAGCACAAAATTCTAACTCCTCAGTGGGGTATAAGGTACAGTTAT
TATTTCAAATCACTCAGCATTCAAGGGACATACAATTACTAGATAATATA
ATAAAGTATTTTGGGTGTGGGAAAATAGAAATAGACCCTAGAAGGTCTGT
ATATAATTTTAGGTTAGAAAAATTTACTGACATTGACAGTAAAATAATTA
CATTTTGGGATAAATATTTATTACAAGGATCAAAGCTTTTAGACTACCGC
GATTTCTGTAAAGTTGCTAGGTTGATGAAAAATAAATCTCATTTAACTTT
ACCAGGGCTGGCTGAAATTAAATCTATTAAATCAGGAATGAATACACTAA
GAGGTCTGTAATTTAGATTTACATAAAGCTTTATATTAGCCAATGCCAAA
TATAAATATATTTATTTCTAAAAAACATGGAGCT

Sequences in the Contig:

SY0AAB51YI06FM1