Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB51YD16FM1
Length(NT) : 513
Best Gene Model Blast : Link to GSTUMT00005117001 E-value : 1e-143
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_00011
Accession: ref|XP_001597925.1| Score: 272 E_value: 8e-23
KEGG Definition: predicted protein
Accession: aor:AO090701000126 Score: 203 E_value: 4e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB51YD16FM1
TTGGCCTACCGTACATACCTTACAAATCCAGCTTGGGAAACAATTTCTTG
TCTACTCATCTCACTCACTCATTCCACTACCGTACACCTTTATCCATCAC
ACACACACACACTACCGGACCACGGACGAAAGAACGGACGAAACCGAGCA
AGCAACCGATGTCCTCCTCGTCACTCATCCAGCTTCTCCAGCGGAAGCGG
TACCAGTACGAGGTTACCTTCTCGCTGTACATGCTTACCCCAACTGAGAA
GATCATCTTCAACTCCTTCCTATTCGTATTCCTCTCCATGCTGATCCTCG
CAGCCTCCTTGTACCTGCCTCATCATATCCATACCATCGCCTCGAGAGCT
TGGTTTTACTACGCGGGGGATGAGGAGTTGGTTCATGCTCCGATACCCGC
GTCGATGAATTGATATTGCTATTGCTGTGGCGGTAAAGGGGAAGATTGGG
AGAGCTCTGCTCTTCTCCCCCTGGTCAGACTGGAGTTTAGAAGGGCAAAT
CCATCAGTAATAG

Sequences in the Contig:

SY0AAB51YD16FM1