Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB51YA01FM1
Length(NT) : 376
Best Gene Model Blast : Link to GSTUMT00006078001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001539658.1| Score: 212 E_value: 6e-16
KEGG Definition: hypothetical protein
Accession: ang:An15g01470 Score: 207 E_value: 1e-15
KOG Definition: No Hit Found
PFAM Definition: N1221, N1221-like protein. The sequences featured in this family are similar to a hypothetical protein product of ORF N1221 in the CPT1-SPC98 intergenic region of the yeast genome. This encodes an acidic polypeptide with several possible transmembrane regions..
Pfam Number: pfam07923 Score: 101 E_value: 9e-06

Sequence:
>SY0AAB51YA01FM1
TTGGCCCGGAGGTGGGCAAGGGAGTAATCACAGCATCGCCATTAGATTAC
CATGTGTTTAGGCAAGACATTATGGCTAAATATCCGGCATACGATCCTCC
AAAACCTCTCTTTCCTTTTGAATTAGCTGCAAACTCCTTTCTACCGTCTT
CTGCCGTTAATACTACGACTGGCCGAACGGGCGGGAATGGTGATGTGCTG
TTGGGGGGAAAGGGTGGCGGTGAGAATTTAGGATCTATCTTGAATAAGGC
TGTTCACATTGCTACTCCTGCCCCGTCGCCTCCGCCGTCTCCCGGGGGTG
TTGGTGGGAAAGGAGGGAAGAAACAGAATTATCAAACAAACAACAATTTC
CCCTTCTTATATCCTCCTTCCTCCTC

Sequences in the Contig:

SY0AAB51YA01FM1