Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YP24FM1
Length(NT) : 448
Best Gene Model Blast : Link to GSTUMT00006847001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_01048
Accession: ref|XP_001247277.1| Score: 354 E_value: 2e-32
KEGG Definition: hypothetical protein
Accession: ncr:NCU08600.1 Score: 323 E_value: 4e-29
KOG Definition: No Hit Found
PFAM Definition: KAR9, Yeast cortical protein KAR9. The KAR9 protein in Saccharomyces cerevisiae is a cytoskeletal protein required for karyogamy, correct positioning of the mitotic spindle and for orientation of cytoplasmic microtubules. KAR9 localises at the shmoo tip in mating cells and at the tip of the growing bud in anaphase..
Pfam Number: pfam08580 Score: 246 E_value: 2e-22

Sequence:
>SY0AAB50YP24FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGGCGGGCCGACGAAATGC
CTTGGAAAAGAAGTGGAAGAAATTGGATAGCGACGTGGAGGGGCTGAAGA
AAGAGTTGGGCGAAGACAAATGGGTTGCGCTATTTAGGAACGCTGGCGTG
CAGACGGCTAATATGATGTCAAGCGTGGAGAGGAGTCTTAAGAAATTGAG
AGACGCAGTTACGATATGGGAAGAGAGCGAGGGGAGGATTGACAGTGATT
TGGCATTGAAGATTCAGAATTACGAAGCAAAGAAAGTGCATTACGGATCT
GCAATTGAACGAGCATTAGGACTTATTACTAAGGGAGTCCGTGATAGGAT
AACTGTTAATGGAGAAATCATTCGTCTCGACGCTGCTATGCGGGCGCGTT
GGAAGACTCTCGAAGATGGAATGGCCGACATGGAACAGGATATGAATG

Sequences in the Contig:

SY0AAB50YP24FM1