Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YO21FM1
Length(NT) : 532
Best Gene Model Blast : Link to GSTUMT00002870001 E-value : 1e-123
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_03846
Accession: ref|XP_001595757.1| Score: 297 E_value: 6e-48
KEGG Definition: hypothetical protein
Accession: ani:AN5637.2 Score: 289 E_value: 1e-45
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 131 E_value: 8e-09
PFAM Definition: No Hit Found
Swissprot: Q9RPT1|RHLG_PSEAE
Gene Ontology:
GO:0004316 = Molecular function: 3-oxoacyl-[acyl-carrier-protein] reductase activity

Sequence:
>SY0AAB50YO21FM1
TTGGCTTCAACTAGTCGTCACGAAATATTTGCATTGCAGCTGAAGAAGAA
GCTCAGTAAGAAAAACAAGAGGAAAAACATACAATGGATGTCTCGACCCT
CTTCTCCGTAAAGGATAAAGTCGTCCTTGTCACCGGTGGGGCAAAAGGAA
TTGGCCGAATGATCTCCGAGGGCTTTGTAGCGAACGGCGCAAAAGTCTAC
ATCTCCAGTCGCGACGCAAAGTCCTGTGAATCCGCCGCAGCAGAATTGAC
CACAATGGGTTTACCCCCTTCCCCATCCCCTCCCACCACAAACGAGACTA
ACAAACACCAGGCCCAGGAACAGCCCACGCCATCCCGGCAGATTTCTATA
AGCTCTCCGACTGCCAGAACCTCGTCGCGGAGCTCAAAAAGCGCGAAACT
AAACTCCACGTGCTGGTGAACAACTCGGGCTCCAATTGGGGCGAGTCGTA
CGATAGGTATCCGGACGCGGCGTGGACCAGGGTGTTGACGTTGAATTTGC
ACCGGGTGTTTACGATCACGCAATTGTGCACG

Sequences in the Contig:

SY0AAB50YO21FM1