Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YO17FM1
Length(NT) : 447
Best Gene Model Blast : Link to GSTUMT00011686001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN0890.2
Accession: ref|XP_658494.1| Score: 334 E_value: 5e-30
KEGG Definition: hypothetical protein
Accession: ani:AN0890.2 Score: 334 E_value: 2e-30
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2615 Score: 128 E_value: 1e-08
PFAM Definition: No Hit Found
Swissprot: P25351|YCR3_YEAST

Sequence:
>SY0AAB50YO17FM1
TTGGCACATTTCCCAATGCCCTAGCGACAAATATTACAGAGGAGGAGCAA
GTGAGAAAGGGACCTCCAATCATCAAAACTTTCACCGCCCCGGTTGTACT
ATTAATCGTGTCCTATGGGATATTGGCTTATCACACCATGGGGTTTGAGC
AACTCTTTCCTGTCTTTTTATCCACCCCTCGGTCTGCGGAACCTCCGCAC
CATCTGCTCAAATTTACTGGTGGTTTTGGATTGGACACCCAGACTATCGG
CTTCATTCTATCAGTACAAGGTGCCGTTTCAATGGCCATCCAATTCCTTT
TCTTTCCACCGATAGTCGAACATTTTGGAACCTTAAGCGTCTATCGGTTT
TGCATGTTTCTATACCCAATATCTTACCTCATAGTTCCATACATTGATTT
TCTCCCCCCGTCGCTCTCCATGGTCGGTGTGTGCGGCGTCCTTCTTG

Sequences in the Contig:

SY0AAB50YO17FM1