Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YL18FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00003386001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543140.1| Score: 471 E_value: 1e-45
KEGG Definition: SNF2 family DNA-dependent ATPase domain-containing protein
Accession: aor:AO090009000349 Score: 468 E_value: 1e-45
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O43065|MOT1_SCHPO

Sequence:
>SY0AAB50YL18FM1
TTGGCAAGCGGCGTCGCAAGAGTGAAAAGAAGGAAGAGCCTACTGCGTCG
CCGCATAATGTTGATGGCCACATGATACATGGTGATGTCGACCTTGTGGG
TGTGGAGACAATTATTAAGACTAAGATTGCTGGTGCGACAGCTTTGGGTA
AAGCCATTAGCCTGTGGCCAAGAGAAGATGCTATCCGCGCTTTCGAACCT
CGGCTTGTTCCGCTATTACAGTCACCCCACTCTACGACTCAATTGGTGAC
GGCAATGATATTTGAGGAATATGCAAGGATAACCTCCGAGGTTACAGATT
TGAAAGCACAATTCTTGGCGGCCCTTACTAACTTTCTTAATTCGGAGAGG
CCTTCCTGTTACCGTGACCTTGTGTCTTATATGCACGTTGTACAAGCTCA
ATGTCGATCCTTGCTTAATGCTTTCCGCGACATTGGTAAAGTGCCATCCT
CGAGAATTCCTACTATCGCTGCGGTATGTCAAGGGGAGTCGGAAGCGGGT
CCCGATGCATTTAGTATTGAGAAGGCGGAGAAGATTGTTGGCGATGAGTT
TGCTCGGTTGAAGCGGGCTTTGGGTCCAACTCAGAAACTCATGTCATCGC
AGGCCCTTGCTGATGC

Sequences in the Contig:

SY0AAB50YL18FM1