Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YK22FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00011680001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: thymidylate kinase family protein
Accession: ref|XP_001309954.1| Score: 324 E_value: 1e-28
KEGG Definition: thymidylate kinase family protein
Accession: tva:TVAG_315260 Score: 324 E_value: 5e-29
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG3327 Score: 480 E_value: 3e-49
PFAM Definition: Thymidylate_kin, Thymidylate kinase..
Pfam Number: pfam02223 Score: 329 E_value: 9e-32
Swissprot: P97930|DTYMK_MOUSE

Sequence:
>SY0AAB50YK22FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGCCCCCATCGGAAAAATGATAAATGCCTACCTCTCCACCTCAA
CCACCCTGGAAGACCACACAATCCACCTCCTCTTCTCCGCCAACCGCTGG
GAACTCTCCGCGCACATCCTGAAACTCCTGAACGACGGCGTTACCATTGT
GTTGGATAGATACGTATACTCCGGGATCGTCTTCAGCGCCGCGAAAGGTC
TCAGCCTGGACTACTGCCGCGCGCCGGACGTGGGCTTGCCAAGGGCGGAC
GTAGTCTTGTTCTTGGATCTGGATGCGGAGGTGGCGAGGCGGCGGGGCGG
GTTCGGCGGTGAGCGGTATGAGGTTGAGGCGGTGCAGAGGAGAGTTAGAG
ATTTGTTTAAGGAGGTTGGAGAAAAAGAGGAGGGGAGGTGGAGGGTTGTG
GATGCTGGGCGCAGTGTGGAGGAGGTCAGAGAGGTGGTTTGGGGGGTTGT
AGAAAGGGTTGTGAAGGAGGTTGAGGGGATGGAGGTTGGGAGATTTGAAT
AGGGTAGCCTGGATTTAGAGG

Sequences in the Contig:

SY0AAB50YK22FM1