Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YJ02FM1
Length(NT) : 542
Best Gene Model Blast : Link to GSTUMT00009089001 E-value : 8e-95
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: ref|XP_448895.1| Score: 764 E_value: 9e-80
KEGG Definition: unnamed protein product [EC:2.7.7.6]; K03021 DNA-directed RNA polymerase III subunit C2
Accession: cgr:CAGL0L02849g Score: 764 E_value: 5e-80
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0215 Score: 819 E_value: 1e-88
PFAM Definition: RNA_pol_Rpb2_6, RNA polymerase Rpb2, domain 6. RNA polymerases catalyse the DNA dependent polymerisation of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). This domain represents the hybrid binding domain and the wall domain. The hybrid binding domain binds the nascent RNA strand / template DNA strand in the Pol II transcription elongation complex. This domain contains the important structural motifs, switch 3 and the flap loop and binds an active site metal ion. This domain is also involved in binding to Rpb1 and Rpb3. Many of the bacterial members contain large insertions within this domain, as region known as dispensable region 2 (DRII)..
Pfam Number: pfam00562 Score: 329 E_value: 9e-32
Swissprot: P22276|RPC2_YEAST
Gene Ontology:
GO:0005666 = Cellular component: DNA-directed RNA polymerase III complex
GO:0003899 = Molecular function: DNA-directed RNA polymerase activity

Sequence:
>SY0AAB50YJ02FM1
TTGGGGTTTCCGAGTTTATTAGTATATACGTTAATCACCATCACAACGGA
GTTCATATCGCAACGGATGGTGGGCGTATTTGCAGGCCGCTGATCATTGT
GGAGAACGGACGGTCAAAGGTTACCCCACGGTATCTCAAGTCGCTGGCGG
GTGGGCGTACAGCGTTTGAGGACTTCCTGAAGAAGGGTCTTGTCGAGTAT
GTCGACTGCAATGAGGAAAACGACGCATATATAGCTGTATACGAACAAGA
GATCACCGAATCTACAACCCATATGGAGATAGAACCTTTTACCCTCCTCG
GCGCGGTAGCCGGCTTGATCCCCTACCCGCATCATAACCAGTCACCCCGC
AACACCTACCAATGCGCTATGGGTAAGCAAGCAATTGGGGCAATAGCGTA
CAACCAATTCCTACGAATAGACACTCTCCTCTACCTTATGGTCTACCCAC
AACAGCCCATGGTCAAGACAAGAACCATCGAACTAATCCAATACGACAAA
CTCCCAGCCGGCCAAAGTGCCATAGTAGCTGTAATGAGTTAC

Sequences in the Contig:

SY0AAB50YJ02FM1