Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YH12FM1
Length(NT) : 632
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein Bm1_17870
Accession: gb|EDP36122.1| Score: 243 E_value: 3e-19
KEGG Definition: LOC769550; hypothetical protein LOC769550
Accession: gga:769550 Score: 151 E_value: 8e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB50YH12FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTCAAAGT
TGTCCCCCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAAACTATA
CAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGT
ACCTTTGCTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAA
AAATCCCAACCCCTGGAAGGGATGTATTTATTAGATAAAAAACCAACGGC
TTCGGCCTCCTTGGTGATTCATGATAACTTAACGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGG
ATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCTATT
CCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGG
CGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTG
ATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCC
CTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAA
TTCCAGCTCCAATAGCGTATATTAAAGTTGTT

Sequences in the Contig:

SY0AAB50YH12FM1