Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YH11FM1
Length(NT) : 412
Best Gene Model Blast : Link to GSTUMT00004819001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 285 E_value: 2e-24
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 283 E_value: 2e-24
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 211 E_value: 2e-18
PFAM Definition: No Hit Found
Swissprot: Q502K3|ANR52_DANRE

Sequence:
>SY0AAB50YH11FM1
TTGGAGATACTCCTGCAGCGAGGTGATGTCAAACCAGATTTACCAGATGG
GGGTGGCCGGGCACCGCTATCACATGCTGCCGGATATGGATATGACGGCA
TGGTGAAGCTACTTTTGAAGCGAAGGGATGTTAATCCGAGTTCACTGGAT
AAGGATGGTCGGACACCACTATCATACGCTGCGGGGTCTGGACATGAGGT
CGTGGTAAAGCTACTCCTCGAGCGAGGGGATGCTAATCCCAAGTGGCCGG
ATAAGGATGACTGGACACCGCTCTATTACGCTGTAGCGTCCCAATCTAAT
GATGTGGTGAAACAGCTCTTTGACCGACGGGAGGTCGATCCCAATTCGTC
AGATAAGTGTGGCTGGACACCACTAATAAATGCTGCTGTATTTGGACATG
AGGGTGTGGTGA

Sequences in the Contig:

SY0AAB50YH11FM1