Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YG09FM1
Length(NT) : 576
Best Gene Model Blast : Link to GSTUMT00000913001 E-value : 1e-135
Numbers of ESTs : 1

Blast Results:

Nr Definition: cytochrome b5
Accession: ref|XP_001215211.1| Score: 328 E_value: 4e-29
KEGG Definition: cytochrome b5
Accession: aor:AO090003000270 Score: 323 E_value: 7e-29
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0537 Score: 257 E_value: 2e-23
PFAM Definition: Cyt-b5, Cytochrome b5-like Heme/Steroid binding domain. This family includes heme binding domains from a diverse range of proteins. This family also includes proteins that bind to steroids. The family includes progesterone receptors. Many members of this subfamily are membrane anchored by an N-terminal transmembrane alpha helix. This family also includes a domain in some chitin synthases. There is no known ligand for this domain in the chitin synthases..
Pfam Number: pfam00173 Score: 240 E_value: 2e-21
Swissprot: Q9P5L0|CYB5_NEUCR
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>SY0AAB50YG09FM1
TATTTAACCTTACAAAATTGATCTGAATAGATTCTCTTCAAATCTCTTAC
CATGTCAGCCGAATATACCTTTGCCGATATTAAAGGACATCAATCGAAGA
AGGATCTTTGGCTTGTTGTCCATGATAAGGTCTACTCTTGTGGGGATTTT
GTTGACGAGCACCCGGGTGGTGAAGAAGTCCTGATGGATGTCGCTGGACA
AGATGCGACCCTTGCCTTCGAGGATGTCGGACATTCGGACGAAGCCCGCG
AAATTCTTAACGGATTGTTGGTTGGCACACTTAAAAGAACGGTATGCTTA
CCAAGTCTTTTGTTATACGCCGGCAATTGTTCAGCAATTGGTTCTAGCTG
ATTTTTAACCCCGTACAGGCATCCGACCCGAAGCCCCCTGTTACCTCTCC
TAGTTTCACGACCCAGACACAGAGCAATGATGCTGGAACTACGTTCTACG
CTTTCTTCGTTGTGGCTGCCCTTGTTGCGTTTGGGGCATACAAGGTGTAC
GCTTAAGTGGCCTGGTGTGGTTGGAGTTGTGAAGGGACAGTGGAAAGAGA
ATTTGGGGTAATATGATCTCTTTTTC

Sequences in the Contig:

SY0AAB50YG09FM1