Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YC23FM1
Length(NT) : 663
Best Gene Model Blast : Link to GSTUMT00001325001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: gb|EDP49026.1| Score: 204 E_value: 1e-14
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_8G01830 Score: 204 E_value: 6e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB50YC23FM1
TTGGCTCAATCCAAATGCAACCAAAGCTTTGGTGTCTTCAGATCCGCGGG
CTGGCTCATCGGATGATGACGGCTCTTCTAATAGCGCTTCTGCTAAGGAT
GTTATCCCGGTAAGCCCTAGACGCTTGGTTAGAGAAGTGGGTTTCACAAT
CTCTGTTTCTCCACCACCGCAACCGCATTATCGAACCGCACTCCTAGCGT
GTTTTCTGGATGGATGTGTACCGCCCGATGGTCCGTCATCTGGGGTCCCT
TCGGTATGGGTTCACGCAATTCCCCGCGCTATAAATTGTGGCGTTCAGGT
TTTGGATACCTCCGCAATGGCAGTGTGCACCGTATTTTTCGGCCGGCAGA
GCAGGGACGAGCGGATCGTCAAGGAGAGTACAAAGATATACACAAGGGCC
TTGGCGCAGCTGAATGCCGCACTCTCGAACAAGACCATGCATACCCGTGA
CGAGACATTAGCGGCGACCATGTTGTTGGGCATGTACGAGACGATGGGGT
GTGCAGATCCGCTCACGTGGCAGCGACATGCAGACGGTATGGAGTTATTA
GTTCGAGTGAGAGGGCCGGAAGCTCATACTACCGAATTGGGCCATCGTTT
ATTTACCAGTTTTCGTGGTACTAGTTTAACCAACTCACTTGTGAGCTGCA
AACGCAACTTCCT

Sequences in the Contig:

SY0AAB50YC23FM1