Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YB04FM1
Length(NT) : 632
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN1569.2
Accession: ref|XP_659173.1| Score: 171 E_value: 7e-11
KEGG Definition: hypothetical protein
Accession: ani:AN1569.2 Score: 171 E_value: 4e-11
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 124 E_value: 7e-08
PFAM Definition: APC_basic, APC basic domain. This region of the APC family of proteins is known as the basic domain. It contains a high proportion of positively charged amino acids and interacts with microtubules..
Pfam Number: pfam05956 Score: 113 E_value: 1e-06

Sequence:
>SY0AAB50YB04FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGTTGTCTGAAATCTGAGCT
AGAACTCTGCTCTCAACTAGCCACCTCCCACTCGGGCCTCAACGAGCTCG
ACTACCCGCACGCCTTCCCCTCTCCGCCCCGTGAAATTTCCACCTCGGTA
GCCTTCCAATCCTCCAACTCCTTCTTCGAGCAGCCCCGCAGCGCACAAAT
CCTCTCCCCCCGCGCCAGCGCAACCACCGCTCCACCCCTCCCAGAAGACC
GCCGAGAAGACGAACTAACCTGGTTCTACTACCTCGCCGAAATCGCTCTC
CGCAAGGTCGAGCTCCGCATGTCGGAAACCTTCTCCCTCTCGCCACCCGC
GCACGCTTCATCCATGAGAGCCTCTACACCCGCCGGCCTCGAAGACACGC
ACCGCCCCATCAAAACCGAAGACCTTCTCTCGAGCGCGTATGAGTTCGAA
CTCCAGTTAGACCTCTGGTACTCCTACCTGCCCAGCGTGTTAAAGTTCCC
CGTAGACTCACGCCTTCCTTGTGAGGACGAGCGGTTGCAGTACCTCCGCA
TGCGCTACTGGTGGATCGTTTCCATGCTTTACAGACCCTTCCTATACCAC
CTCATACACCACCCCACCCTGACCCCACCGAC

Sequences in the Contig:

SY0AAB50YB04FM1