Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB50YA19FM1
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00012190001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_05799
Accession: ref|XP_001241903.1| Score: 142 E_value: 2e-07
KEGG Definition: predicted protein
Accession: aor:AO090120000090 Score: 132 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB50YA19FM1
TTGGAGACCTCGTCCGGCTCCAGCGCTTCGCCCGACTCCTAAAAACCAGC
CCGACCTTTGAAGTCAACAACGACACGGACTACGACGAGCTCCGCGCGAC
CATATGCATCCTGGACATCGCCATCGATGACGGCCCCACATCCGGTGAAC
CTAACATGAACGATCTAGAGGTAGATGTACTCGTGGAGAACTTTAGGAAC
ATGTTCTCCAAGATTAGGGATACGAATGCGCAGAATCTGTCGAGGACGGA
GTCGAAGGACGTTATCGAGAGGTTGATGTTCAGGCTCAGGTTTGGCGTGA
GGAAGAGGGAGAAGATGAACCTTGTTGTTGACACCGCTTTTGGCACGGAG
TGGGCCGGAAAGGGCGGGAAGACACAGACGAAGTTGAAGTTGAAACCGAA
GGAGAAGATGGAGGGGGATGATATAGGGGATGAGGGGGTGGAGGGGGCGG
AGTAGCGACTATTGGCAATATCATAATGTGTTTTGGTTCCCTCTTCCCCC
GCACTTGATGTATTCTAGTACTCATACCTGAGGCTTTCCCTTCTCTCCTT
TCTTTCTCAAAGTTTCTTTCTTTCTTTCTTTCTCTTTTGACCTCATTCCC
TTACCAAAATCTTGCGAAAATAACTGGCGTTATGACTTTTTTTCCCCT

Sequences in the Contig:

SY0AAB50YA19FM1