Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB4YN17FM1
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00012112001 E-value : 6e-68
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61634.1| Score: 340 E_value: 2e-30
KEGG Definition: molecular chaperone (HSP90 family); K04079 molecular chaperone HtpG
Accession: aor:AO090102000620 Score: 340 E_value: 1e-30
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 295 E_value: 9e-28
PFAM Definition: No Hit Found
Swissprot: O43109|HSP90_PODAN

Sequence:
>SY0AAB4YN17FM1
TTGGTGCACAGTCAGGGGAAAGGGTCTGGGACTGCTTCAATCAGAGCAAT
TCCAGCACCTTCTCTGGTTCTTTGGGTTTCTTTGCCGCGGGGCTTTATTT
GGTGGGGCTATCCCGTTTTTGCGGCTTTGTTGGAGGGTGTGGAATCTACT
AGAATGTGCGGTGCCGAGTCTTGGCACCAGGACTCCCCCCTCTAAATTCA
CCACCGCTTCGCCCCAACTTCTCTCCTCTTCCTCCCTCTCCCTCAGAATA
ATCATCGTCTAGAGAAACACTCTCGACTTTTCTCAGAGCCCAATCAATTT
CTCCTGCATCTCCTCATTCACCTCTCTATTTCCCTGCACCTTTAGAGATT
CATAGACCCGAGAAGATAGCAAACAACCATTGCCATGGCTGAAACCTTCG
AATTCCAAGCTGAGATCTCTCAGTTGCTCTCCCTCATCATTAATACTGTA
TACTCGAATAAGGAGATTTTCCTTCGAGAATTGATCTCCAATGCCTCAGA
CGCTTTGGACAAGATTCGCTACATTTCTCTTTCCGACGCTAGCGTCTTGG
AAGAGGAGAAGGATCTGAAAATTCACATTATCCCTAACAAGGAGGCCAAG
ACTCTTTCAATTTTTGATACTGGTATCGGCTTTACT

Sequences in the Contig:

SY0AAB4YN17FM1