Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB4YM14FM1
Length(NT) : 690
Best Gene Model Blast : Link to GSTUMT00005952001 E-value : 1e-121
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001213559.1| Score: 281 E_value: 2e-23
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 274 E_value: 5e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB4YM14FM1
TTGGGTGTATATTTCTGCTTGTTTTGCTCAACATCGACGCTATTCTGGGA
GAGGTGACAATTCGCCAAAGAAGGAAGAAACTTGAAAAGATGACACAGGG
TAATGGGCTGAGTGATGCATACACAGCAACCCTAACCCGACTGAAGGCGC
AGAGGGGAAATAAATCAGCACTCGGACTTAGGGTCCTGATGTGGGTGCTG
TATTCCAAACGGCCATTACGAGCTGAGGAGCTCCGTCATGCCTTGGGGGT
CGAGATGGGATCTGCAGACCTGGATCCTGACAACGTTCCTGCGCTACGGA
CACTGCTGGCATCTTCTCTGGGCCTTGTCATGGTCGAAGCGCCTTTGTCT
ACTGTCCGATTGGTGCACTTTACTCTGCAAGAGCATCTCTTAAGAGATAC
AACCCTATTCCATAGTCCCCACGCAATAATTGCGGAGGTTTGCTTGACAT
ACCTCAATTTTGGAAGTGTCAGGGATCTTTCACCAACTTCTTACAAGGCC
CCCCCAACAATGCCCCTTCTAGAATATTCTTCTTGTTACTGGGGGAATCA
CATGAGAATGGGCATGACAGAGAATGTGAAGATGCTTGCACTGAGGCTTC
TCCGGGGATTTGATAAGCATATATCTGCTCAACTGATGTTATTGCACTAT
GATCTATATGAAGGCTTGGCCGCTTATTTGCACAGCACGG

Sequences in the Contig:

SY0AAB4YM14FM1