Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB4YK06FM1
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00002542001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_03349
Accession: ref|XP_360806.1| Score: 457 E_value: 6e-44
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03349 Score: 457 E_value: 3e-44
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2722 Score: 116 E_value: 6e-07
PFAM Definition: Mem_trans, Membrane transport protein. This family includes auxin efflux carrier proteins and other transporter proteins from all domains of life..
Pfam Number: pfam03547 Score: 136 E_value: 2e-09

Sequence:
>SY0AAB4YK06FM1
TTGGCGGAAAAATCACTCGACCAAGCGAGAAAACACGCACGCAAGCAAGA
CTGCAAAGAGACTGTCTATTGATTCGAGATATGTCGGATTCCGGAGCATC
CCTGAAACAGTCTTTTCTCGGAGCCTTGCAAGCCTCGCTGTCTGTCCTGC
TAACCCTAGGGTATGGAGTCCTCTCGGCGAAGCTGAGGCTTGTGCATCCC
CGAAGTGTGGGAGATGTATCTCGCCTCTGCGTCGACGTGTTCCTACCAGC
GTTGCTGATAACGAGCATTGGACGGCAATTGACGCTGGAGGGCGTGGGGA
ACTACGCACCGGTTTTCATCTGGGGCATAGTGTACACATTCACCTCCATA
GCTCTTGGCGCCCTCGGAAAGAAAGTTATGAATTTGCCGGACTGGATAGT
TCCTGCCGTTGCCTTCAATAATACTACTTCCCTACCGCTCCTACTCATGC
AATCCCTCGCCGCGACGGGGATTCTCAAGGGTATTTCAGGCGGAGGCCAG
CGGGATGCCGTGGAACGCGCGAAAAGTTACTTCCTTATCAACTCTATGGT
TTCAAACACACTCATGTTCGCCCTTGGACCAAAGTTGATGGACAAGAATG
AGTCCGAGAGCGCCAACGGCCGCGATGCCGAAGCTCAACGCGATCAGGAT
AGTGA

Sequences in the Contig:

SY0AAB4YK06FM1