Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB4YI13FM1
Length(NT) : 601
Best Gene Model Blast : Link to GSTUMT00001325001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001247957.1| Score: 132 E_value: 2e-06
KEGG Definition: predicted protein
Accession: aor:AO090102000007 Score: 129 E_value: 3e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB4YI13FM1
TTGGCGTGCGCTACATTCGGTATCTGTTTCTCCAAAGCGAATCTCGCATC
CTCATCTTCATTAATTCATAATACCGGTGCCGACGGAAGCGCCATCAGAA
GTCTCCAGCTACGAGTAAAGGTCCCCAGCGAGTTCCCCGGCTCTGGAGAC
TGGGCTCAAGTATCGGTACTGCCACCTCGTCCTGCCAACATCGCATGAGC
TCGCTGAGCTGCTAGGCGTTCCCATCCTCTCGCGGATTGCAACTCTTTTG
GGAATAGCTCATACTACCGAATTGGGCCATCGTTTATTTACCAGTTTTCG
TGGTACTAGTTTAACCAACTCACTTGTGAGCTGCAAACGCAACTTCCTTG
CGTCCAAAGAATGGCTCACCATCCCCTGGACCAAGACCCAAAAGACCCCG
ATGCAGCAACTACAAGACCTGCATTTGGAACTCCCGGGTATTCTCGAAGC
TCGACGCGCACTCCCGCGCTCCGCTCATCCCTCGCTGCTCAGGCGGTGCC
TAGATTTTAAGGCCAAGCTGGAAGCATGGTATGAAAACTTTATATCCACC
CCCAGCGCGCACCACTGGCTAGAGTTCTCCGCCTTAAACATTGACCCCCC
G

Sequences in the Contig:

SY0AAB4YI13FM1