Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB4YE16FM1
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00007503001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: transcriptional activator spt7
Accession: ref|XP_754519.1| Score: 342 E_value: 1e-30
KEGG Definition: transcriptional activator spt7
Accession: afm:AFUA_3G11000 Score: 342 E_value: 6e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB4YE16FM1
TTGGGTTGAGTTAGAGGAAGCAGGTGCCCTTGAGGTTGACGCTGAGGGGG
AAAGCGATGATGAGCCTATAATGTCTACTCGTGGCAGAAAGGCACCTGGA
ACTAAGAAGACTAGGAAAGGTGCTCGGCTGGAAGGGACTCCTGAAGTTAA
AGCGCCAGTCGTAAATCTTTTGCGAGCAGATTCCAACCCTCCGGGTAATG
ATAGTCAAGTTTCTGTTGGCATCAATGGTTTTCCAACACCATCTGGCAGC
ACCCCTATTCCTAATGGCCTTGTGCACTCAATATCGCAAATGGATATTGA
TCATGACAGGGTCGATGATGATACGCATGATGTAGAGTATCAGACGTGGA
AAACTTTGACAAAGAAGGCAAGGGCGAAGGTGGCAAGCGAGAGACACAAG
TTATTTCGTGGCAATCGTTTGAATCCGGAAGAACCGGCTTTATTACGATC
CCGGGATGATATGGGGCGGTTTTTGAGGAACGAAGAGAAGCACGCCAAGT
CAACCCAGGATGCTGACGACAGCAGCATGCAACAAGGAAGTGGTAATACG
AAATTGGTTGATACGGAACAACCAGACGTTCAGGAACTACTTCCGGATTA
CTACGACCCTTTGGCCGCGGTCCCGGAGCTTCCTTCTGGTGTCTCATGGT
ATGGC

Sequences in the Contig:

SY0AAB4YE16FM1