Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB4YD06FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00007214001 E-value : 1e-115
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 534 E_value: 6e-53
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 458 E_value: 2e-44
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 282 E_value: 3e-26
PFAM Definition: No Hit Found
Swissprot: Q9Y283|INVS_HUMAN
Gene Ontology:
GO:0005819 = Cellular component: spindle

Sequence:
>SY0AAB4YD06FM1
TTGGAGAACGGGCATGAGGGGGTAGTAAAGATGCTTTTGGAACGAGGGGA
TGTCAATCCCGACCAGATATACACGGAATATGACCGGACGCCACTCTCGT
GGGCGGCTGAGAACGGACATGAGGGGGTAGTAAAGATGCTTTTGGAACGA
GGGGATGTCAATCCCAACCAGATAGACACGGAATATGGCCGGACGCCACT
CTTGTGGGCCGCTGTACGCGGGCATGAGGAGGTAGTAAAAATGCTTTTGG
AACGAGGGGATGTCAATCCCAACCAGATAGACACGGAATATGGCCGGACG
CCACTCTCGTGGGCCGCTGTTTGCGGGCATGAGGAGGTAGTAAAAATGCT
TTTGGAACGAAGGGATGTCAATCCCAACCAGATAGACACGGAATATGGCC
GGACGCCACTCTTGTGGGCCGCTGTTTGCGGGCATTCTGGGGTAGTAAGA
GTGCTTTTGGAACGAGGGGATGTCAACCCCGACCAGGCAGACACTGAATA
TGGCCAGATGCCACTCTCGTGGGCCGCGGACAACGGGCATGAGGGGGTAG
TAAAGATGCTTTTGGAACGGAAAGATGTGCGCACCGCCACCCCGGATAAT
GCGAATCAAACGCCATTGTCGAGGGCTCTCTCTAGAGGACATG

Sequences in the Contig:

SY0AAB4YD06FM1