Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB4YB19FM1
Length(NT) : 692
Best Gene Model Blast : Link to GSTUMT00001656001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An12g00550
Accession: ref|XP_001395143.1| Score: 382 E_value: 3e-43
KEGG Definition: hypothetical protein
Accession: ang:An12g00550 Score: 382 E_value: 2e-43
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG2659 Score: 173 E_value: 2e-13
PFAM Definition: No Hit Found
Swissprot: Q6VN19|RBP10_MOUSE

Sequence:
>SY0AAB4YB19FM1
CGCATTCAGAGATATCAAGGGAAAATTATACCCAGCAGTTGGCATGAAAA
GGCCTGGGGAGCACGTCCGTGTCAATTTTGGTCAAGAGAGGTTTGTTTTT
GATATTGATCATTACATGAATAACGAAGAGAAAAGTTTACGACGAGATCA
ACAACCACCCTACAGCGGGTCTTTGCCCCTCCCTTGATGAGGCTGCCCTG
ATACAGGCTCTCGTATCGCAATATCTTGCTCACGACGGATATGTTGATAC
TGCAAGGGCGTTTTCAGATGATGTCCAAAACGAGGCTAGGGCCTTAGATA
GTGGACGATCTGGTGCTCTGAAAACTCTAGAGATGAAGGAAGATAAAGAT
GCAATACATCGCCAAAAAATTCGGGGCGCGATTCTCGAAGGTGACGTGGA
TCGCGCACTTGACCTCACCAACAAACACTACCCTGCTGTTTTGCCTAACA
ACCAGGCGATATTTTTTAGATTACGTTGTAGGAAACTAGTGGAGATGATC
AGGCAGTTTGCGGAGAAGGTTCACGATGGCCCTACTGGCTCGAGTGGTTC
CCACGATGACCCCATCGTCGGTGTTTTCGCGCAAGACATGGAAATAGACG
ACCCCGCAGGCGCCGGAACTGGTTGGGAGGAGATGGATGTTGAAGATGAA
GATGGGAGTGGTGGCGTTGAAACAGGTATGGGGGTGGATCAG

Sequences in the Contig:

SY0AAB4YB19FM1